Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 218
Filter
1.
Sci Rep ; 14(1): 6682, 2024 03 20.
Article in English | MEDLINE | ID: mdl-38509195

ABSTRACT

Abnormal hemoglobin anti-Lepore Hong Kong is a rare ßδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of ß0-thalassemia and α-thalassemia (-SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with ß0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2-40.8%) and behaved with ß-thalassemia trait. Furthermore, determination of the α/ß-mRNA ratio revealed a slight downregulation of ß-globin, similar to that of ß-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, ß0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.


Subject(s)
Hemoglobins, Abnormal , alpha-Thalassemia , beta-Thalassemia , Humans , Pregnancy , Female , alpha-Thalassemia/genetics , Hemoglobins, Abnormal/genetics , beta-Thalassemia/genetics , beta-Globins/genetics
2.
J Hazard Mater ; 469: 133994, 2024 May 05.
Article in English | MEDLINE | ID: mdl-38503210

ABSTRACT

The efficient remediation of the soil co-contaminated with heavy metals and polybrominated diphenyl ethers (PBDEs) from electronic disassembly zones is a new challenge. Here, we screened a fungus of F. solani (F.s) can immobilize Cd and remove PBDEs. wIt combined with tourmaline enhances the remediation of co- pollutants in the soil. Furthermore, the environment risks of the enhanced technology were assessed through the amount of Cd/BDE-153 in Amaranthus tricolor L. (amaranth) migrated from soil, as well as the changes of soil microorganism communities and enzyme activities. The results showed the combined treatment of tourmaline and F.s made the removal percentage of BDE-153 in rhizosphere soil co-contaminated with BDE-153 and Cd reached 46.5%. And the weak acid extractable Cd in rhizosphere soil decreased by 33.7% compared to control group. In addition, the combined remediation technology resulted in a 32.5% (22.8%), 45.5% (37.2%), and 50.7% (38.1%) decrease in BDE-153 (Cd) content in the roots, stems, and leaves of amaranth, respectively. Tourmaline combined with F.s can significantly increase soil microorganism diversity, soil dehydrogenase and urease activities, further improving the remediation rate of Cd and BDE-153co-pollutants in soil and the biomass of amaranth. This study provides the remediation technology of soil co-contaminated with heavy metal and PBDEs and ensure the maintenance of food security.


Subject(s)
Amaranthus , Environmental Pollutants , Metals, Heavy , Polybrominated Biphenyls , Silicates , Soil Pollutants , Soil , Cadmium , Biodegradation, Environmental , Halogenated Diphenyl Ethers/analysis , Soil Pollutants/analysis , Metals, Heavy/analysis
3.
Hum Genomics ; 17(1): 111, 2023 Dec 08.
Article in English | MEDLINE | ID: mdl-38062488

ABSTRACT

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.


Subject(s)
beta-Thalassemia , Pregnancy , Female , Humans , beta-Thalassemia/genetics , beta-Globins/genetics , Prenatal Diagnosis , Sequence Deletion/genetics , China , Mutation
4.
Materials (Basel) ; 16(17)2023 Sep 01.
Article in English | MEDLINE | ID: mdl-37687712

ABSTRACT

Cast defects are common in cast alloys and they are difficult to eliminate without deformation. They strongly degrade the mechanical properties of cast alloys. The addition of some elements can affect the number of cast defects. In this work, the deleterious effect of Sn addition on the mechanical properties of Al-Si alloys has been investigated via 3D-computed tomography, SEM and TEM. Amorphous Sn oxides were found near the alumina film or formed enclosures with alumina film. The melt containing high Sn content was trapped by enclosures, causing more shrinkage pores during solidification. Cracks likely initiated and expanded along these pores and brittle amorphous Sn oxides, deteriorating the mechanical properties. This work suggests not adding Sn to various Al alloys when used in a cast state.

5.
Appl Opt ; 62(20): 5508-5515, 2023 Jul 10.
Article in English | MEDLINE | ID: mdl-37706869

ABSTRACT

For effective wavefront management in the optical infrared range, dynamic all-dielectric metasurfaces, always based on phase transition materials, particularly G e 2 S b 2 T e 5 (GST), can be used. In this paper, we propose a GST-based tunable metasurface by structuring the phase-change material GST. We confirm that the nanopillar we designed has high transmittance in the wavelength band around 1550 nm and can fully cover the 0∼2π phase. Based on these characteristics, we can achieve beam steering and a focusing effect in amorphous phase by elaborately arranging GST nanopillars, while the aforementioned optical phenomena disappear in crystalline phase. Additionally, by arranging the array of vortex phases, we also realize switching the perfect composite vortex beam (PCVB) when changing the crystal state of GST, and simulate the generation of PCVB with different topological charges and sizes in amorphous phase. We believe that our research results can serve as a reference for multifunctional optical surfaces, dynamic optical control, optical communication, and information processing.

6.
Neurourol Urodyn ; 42(6): 1344-1351, 2023 08.
Article in English | MEDLINE | ID: mdl-37306331

ABSTRACT

AIMS: To determine the role of opioid and ß-adrenergic receptors in bladder underactivity induced by prolonged pudendal nerve stimulation (PNS). METHODS: In α-chloralose anesthetized cats, 30-min PNS was applied repeatedly for 3-9 times to induce poststimulation or persistent bladder underactivity. Then, naloxone (opioid receptor antagonist, 1 mg/kg, IV) or propranolol (ß-adrenergic receptor antagonist, 3 mg/kg, IV) was given to reverse the bladder underactivity. After the drug treatment, an additional 30-min PNS was applied to counteract the drug effect. Repeated cystometrograms were performed by slowly (1-2 mL/min) infusing the bladder with saline via a urethral catheter to determine the bladder underactivity and the treatment effects. RESULTS: Prolonged (2-4.5 h) PNS induced bladder underactivity evident as a large bladder capacity (169 ± 49% of control) and a reduced amplitude of bladder contraction (59 ± 17% of control). Naloxone fully reversed the bladder underactivity by reducing bladder capacity to 113 ± 58% and increasing the amplitude of bladder contraction to 104 ± 34%. After administration of naloxone an additional 30-min PNS temporarily increased the bladder capacity to the underactive bladder level (193 ± 74%) without changing the amplitude of the bladder contraction. Propranolol had no effect on bladder underactivity. CONCLUSIONS: A tonic enkephalinergic inhibitory mechanism in the CNS plays a critical role in the bladder underactivity induced by prolonged PNS, while the peripheral ß-adrenergic receptor mechanism in the detrusor is not involved. This study provides basic science evidence consistent with the clinical observation that comorbid opioid usage may contribute to voiding dysfunction in patients with Fowler's syndrome.


Subject(s)
Pudendal Nerve , Urinary Bladder Diseases , Cats , Animals , Urinary Bladder , Analgesics, Opioid/pharmacology , Propranolol/pharmacology , Receptors, Adrenergic, beta , Reflex/physiology , Electric Stimulation , Naloxone/pharmacology
7.
Nanomaterials (Basel) ; 13(12)2023 Jun 09.
Article in English | MEDLINE | ID: mdl-37368259

ABSTRACT

In this paper, we demonstrate an adjustable trifunctional absorber that can achieve the conversion of broadband, narrowband and superimposed absorption based on the phase transition material vanadium dioxide (VO2) in the mid-infrared domain. The absorber can achieve the switching of multiple absorption modes by modulating the temperature to regulate the conductivity of VO2. When the VO2 film is adjusted to the metallic state, the absorber serves as a bidirectional perfect absorber with switching capability of wideband and narrowband absorption. The superposed absorptance can be generated while the VO2 layer is converted to the insulating state. Then, we introduced the impedance matching principle to explain the inner mechanism of the absorber. Our designed metamaterial system with a phase transition material is promising for sensing, radiation thermometer and switching devices.

8.
Neuromodulation ; 2023 Apr 29.
Article in English | MEDLINE | ID: mdl-37125972

ABSTRACT

OBJECTIVE: The purpose of this study is to determine whether adaptively stepwise increasing the intensity of a high-frequency (10 kHz) biphasic stimulation (HFBS) can produce nerve conduction block without generating a large initial response. MATERIALS AND METHODS: In anesthetized cats, three cuff electrodes were implanted on the left pudendal nerve for stimulation or block. The urethral pressure increase induced by pudendal nerve stimulation was used to measure the pudendal nerve block induced by HFBS. RESULTS: HFBS applied suddenly with a large step increase in intensity induced a large (86 ± 16 cmH2O) urethral pressure increase before it blocked pudendal nerve conduction. However, HFBS applied by adaptively stepwise increasing the intensity every 10 to 60 seconds over a long period (33-301 minutes; average 108 ± 35 minutes) with many small intensity increases (0.005-0.1 mA) induced no response or low-amplitude high-frequency urethral pressure changes before it blocked pudendal nerve conduction. The minimal HFBS intensities required by the two different methods to block pudendal nerve conduction are similar. CONCLUSION: This study is important for better understanding the possible mechanisms underlying the HFBS-induced nerve block and provides the possibility of developing a new nerve block method for clinical applications in which an initial large response is a concern.

9.
Opt Lett ; 48(9): 2409-2412, 2023 May 01.
Article in English | MEDLINE | ID: mdl-37126285

ABSTRACT

Topological charge (TC) is generally acknowledged as an important attribute of an optical vortex (OV), which indicates the twisted characterization of the wavefront. In most circumstances, the TC remains constant as an integer or fraction along the azimuthal direction. Herein, by transforming the TCs into the trigonometric functions of the azimuthal angle to tailor the spiral phase distributions, we numerically demonstrate generating perfect vortex beams (PVBs) with sine-function TC based on the all-dielectric geometric metasurfaces, whose unit structure is optimized to an ideal half-wave plate. To seek the intrinsic advancements of the proposed PVBs, their orbital angular momentum (OAM) as well as optical gradient force distributions are calculated for diverse particle manipulation. We believe our proposed scheme is desired to provide an original thought for OAM manipulation, information storage, and optical communication.

10.
NPJ Sci Food ; 7(1): 21, 2023 May 24.
Article in English | MEDLINE | ID: mdl-37225736

ABSTRACT

Probiotic functional products have drawn wide attention because of their increasing popularity. However, few studies have analyzed probiotic-specific metabolism in the fermentation process. This study applied UPLC-QE-MS-based metabolomics to track changes in the milk metabolomes in the course of fermentation by two probiotic strains, Lacticaseibacillus paracasei PC-01 and Bifidobacterium adolescentis B8589. We observed substantial changes in the probiotic fermented milk metabolome between 0 and 36 h of fermentation, and the differences between the milk metabolomes at the interim period (36 h and 60 h) and the ripening stage (60 h and 72 h) were less obvious. A number of time point-specific differential metabolites were identified, mainly belonging to organic acids, amino acids, and fatty acids. Nine of the identified differential metabolites are linked to the tricarboxylic acid cycle, glutamate metabolism, and fatty acid metabolism. The contents of pyruvic acid, γ-aminobutyric acid, and capric acid increased at the end of fermentation, which can contribute to the nutritional quality and functional properties of the probiotic fermented milk. This time-course metabolomics study analyzed probiotic-specific fermentative changes in milk, providing detailed information of probiotic metabolism in a milk matrix and the potential beneficial mechanism of probiotic fermented milk.

11.
Hum Genomics ; 17(1): 38, 2023 04 25.
Article in English | MEDLINE | ID: mdl-37098594

ABSTRACT

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.


Subject(s)
East Asian People , alpha-Globins , Humans , alpha-Globins/genetics , alpha-Thalassemia/genetics , Anemia, Hypochromic/genetics , East Asian People/genetics , Mutation
12.
Hematology ; 28(1): 2184118, 2023 12.
Article in English | MEDLINE | ID: mdl-36867091

ABSTRACT

OBJECTIVE: In the present study, two unrelated cases of Hb Q-Thailand heterozygosity unlinked with the (-α4.2/) α+-thalassemia deletion allele were identified by long-read single molecule real-time (SMRT) sequencing in southern China. The aim of this study was to report the hematological and molecular features as well as diagnostic aspects of the rare manifestation. METHODS: Hematological parameters and hemoglobin analysis results were recorded. A suspension array system for routine thalassemia genetic analysis and long-read SMRT sequencing were applied in parallel for thalassemia genotyping. Traditional methods, including Sanger sequencing, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA), were used together to confirm the thalassemia variants. RESULTS: Long-read SMRT sequencing was used to diagnose two Hb Q-Thailand heterozygous patients for whom the hemoglobin variant was unlinked to the (-α4.2/) allele for the first time. The hitherto undescribed genotypes were verified by traditional methods. Hematological parameters were compared with those of Hb Q-Thailand heterozygosity linked with the (-α4.2/) deletion allele in our study. For the positive control samples, long-read SMRT sequencing revealed a linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele. CONCLUSIONS: Identification of the two patients confirms that the linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele is a common possibility but not a certainty. Remarkably, as it is superior to traditional methods, SMRT technology may eventually serve as a more comprehensive and precise method that holds promising prospects in clinical practice, especially for rare variants.


Subject(s)
Hemoglobins, Abnormal , alpha-Thalassemia , Humans , Alleles , Heterozygote
13.
Zhongguo Gu Shang ; 36(3): 284-8, 2023 Mar 25.
Article in Chinese | MEDLINE | ID: mdl-36946025

ABSTRACT

OBJECTIVE: To provide guidance for hip replacement by analyzing the variation of femoral head rotation center in different hip diseases. METHODS: A total of 5 459 patients were collected from March 2016 to June 2021, who took positive and proportional plain films of both hips for various reasons. The relative position between the rotation center of the femoral head and the apex of the greater trochanter was measured. The positive variation is more than 2 mm above the top of the great trochanter, and the negative variation is more than 2 mm below the top of the great trochanter. A total of 831 patients with variation of femoral head rotation center were collected and were divided into 4 groups according to different diseases, and the variation was counted respectively. There were 15 cases in the normal group involving 10 cases of positive variation and 5 cases of negative variation. There were 145 cases of avascular necrosis of femoral head involving 25 cases of positive variation and 120 cases of negative variation. There were 346 cases of congenital hip dysplasia involving 225 cases of positive variation(including 25 cases of typeⅠ, 70 cases of type Ⅱ, 115 cases of type Ⅲ and 15 cases of type Ⅳ), and 121 cases of negative variation(including 50 cases of crowe typeⅠ, 60 cases of typeⅡ, 10 cases of type Ⅲ and 1 case of type Ⅳ). There were 325 cases of hip osteoarthritis group involving 45 cases of positive variation and 280 cases of negative variation. RESULTS: There was significant difference in variation of femoral head rotation center among the four groups(P<0.05). There was significant difference in variation of femoral head rotation center among different types of congenital hip dysplasia(P<0.05). There were significant differences in cervical trunk angle and eccentricity among different variations of femoral head rotation center(P<0.05). CONCLUSION: The variation of femoral head rotation center is related to cervical trunk angle and eccentricity. The variation of femoral head rotation center is an important factor in hip diseases. The variation of femoral head rotation center is different in different hip diseases. Avascular necrosis of the femoral head and osteoarthritis of the hip were mostly negative variations. With the aggravation of congenital hip dysplasia, the variation of femoral head rotation center gradually changed from negative variation to positive variation.The variation of femoral head rotation center should be paid attention to in the preoperative planning of hip arthroplasty. It is of great significance to select the appropriate prosthesis and place the prosthesis accurately.


Subject(s)
Arthroplasty, Replacement, Hip , Hip Dislocation, Congenital , Hip Prosthesis , Humans , Femur Head/diagnostic imaging , Femur Head/surgery , Hip Dislocation, Congenital/surgery , Arthroplasty, Replacement, Hip/methods , Femur/surgery , Retrospective Studies , Treatment Outcome
14.
Hematology ; 28(1): 2187154, 2023 Dec.
Article in English | MEDLINE | ID: mdl-36939273

ABSTRACT

BACKGROUND: Hb Chapel Hill [Alpha2 74(EF3) Asp > Gly] results from an GAC > GGC substitution at codon 74 of the HBA1 or HBA2 genes. Hb Chapel Hill has not been reported since 1986. METHODS: A heterozygous mutation, HBA2: c.224A > G, was identified in the proband, her father and sister. We compared the haematological and clinical data of this family with the data reported in the limited number of individuals. RESULTS: Having excluded iron deficiency, the Hb Chapel Hill was asymptomatic in heterozygous state. The cases presented here characterize cases in new techniques including capillary electrophoresis (CE). Two aberrant peaks were identified by CE, a major peak migrating in the zone 7 that correspond to Hb Chapel Hill (αChapel Hill 2ß2) and a minor peak migrating in the zone 1 that correspond to Hb Chapel Hill2 (αChapel Hill 2δ2). Focusing on the variant expression, the Hb Chapel Hill plus Hb A2 variant were around 18.9-20.6% of total Hb in three members. CONCLUSION: This data will be useful for providing up-to-date and high quality information on the Hb Chapel Hill.


Subject(s)
Hemoglobins, Abnormal , alpha-Thalassemia , Female , Humans , alpha-Globins/genetics , alpha-Thalassemia/genetics , East Asian People , Hemoglobins, Abnormal/genetics , Hemoglobins, Abnormal/metabolism , Heterozygote , Mutation , Male
15.
J Hazard Mater ; 448: 130880, 2023 04 15.
Article in English | MEDLINE | ID: mdl-36736216

ABSTRACT

Cadmium (Cd) contamination is becoming a widespread environmental problem. However, the differential responsive mechanisms of Cd hyperaccumulator Solanum nigrum to low or high dose of Cd are not well documented. In this study, phenotypic and physiological analysis firstly suggested that the seedlings of S. nigrum showed slight leaf chlorosis symptoms under 25 µM Cd and severe inhibition on growth and photosynthesis under 100 µM Cd. Further proteomic analysis identified 105 differentially expressed proteins (DEPs) in the Cd-treated leaves. Under low dose of Cd stress, 47 DEPs are mainly involved in primary metabolic processes, while under high dose of Cd stress, 92 DEPs are mainly involved in photosynthesis, energy metabolism, production of phytochelatin and reactive oxygen species (ROS). Protein-protein interaction (PPI) network analysis of DEPs support above differential responses in the leaves of S. nigrum to low and high dose of Cd treatments. This work provides the differential responsive mechanisms in S. nigrum to low and high dose of Cd, and the theoretical foundation for the application of hyperaccumulating plants in the phytoremediation of Cd-contaminated soils.


Subject(s)
Soil Pollutants , Solanum nigrum , Solanum nigrum/metabolism , Cadmium/metabolism , Proteomics , Soil Pollutants/metabolism , Plant Roots/metabolism , Biodegradation, Environmental , Soil
16.
J Dairy Sci ; 106(4): 2303-2313, 2023 Apr.
Article in English | MEDLINE | ID: mdl-36823014

ABSTRACT

Streptococcus thermophilus has been extensively applied in fermented milk. This study used gas chromatography-ion mobility spectroscopy to determine and evaluate the volatile metabolites in raw milk, milk fermented at 37°C, and milk fermented at 42°C. Ten discriminatory volatile metabolites were identified at different incubation temperatures: acetone, 2-heptanone, 2-pentanone, 2-hexanone, butanal, hexanal, ethyl acetate, 3-methylbutanal, 3-methylbutanoic acid, and 2-methylpropanoic acid, indicating that fermentation temperature affected the spectrum of volatiles in milk fermented by different strains of S. thermophilus. Specifically, fermentation at 37°C led to accumulation of short-chain fatty acids, whereas fermentation at 42°C enriched ketones and other flavor substances in the fermented milk, enhancing the flavor of the product. This work examined the differences between the volatile metabolites produced by different S. thermophilus strains fermented at different temperatures to evaluate the effect of temperature on the metabolic pathways.


Subject(s)
Milk , Streptococcus thermophilus , Animals , Milk/chemistry , Streptococcus thermophilus/metabolism , Temperature , Fermentation , Metabolome
17.
Plant Mol Biol ; 111(4-5): 393-413, 2023 Mar.
Article in English | MEDLINE | ID: mdl-36645624

ABSTRACT

NAC (NAM, ATAF1/2, CUC2) transcription factors (TFs) constitute a plant-specific gene family. It is reported that NAC TFs play important roles in plant growth and developmental processes and in response to biotic/abiotic stresses. Nevertheless, little information is known about the functional and evolutionary characteristics of NAC TFs in mangrove plants, a group of species adapting coastal intertidal habitats. Thus, we conducted a comprehensive investigation for NAC TFs in Avicennia marina, one pioneer species of mangrove plants. We totally identified 142 NAC TFs from the genome of A. marina. Combined with NAC proteins having been functionally characterized in other organisms, we built a phylogenetic tree to infer the function of NAC TFs in A. marina. Gene structure and motif sequence analyses suggest the sequence conservation and transcription regulatory regions-mediated functional diversity. Whole-genome duplication serves as the driver force to the evolution of NAC gene family. Moreover, two pairs of NAC genes were identified as positively selected genes of which AmNAC010/040 may be imposed on less constraint toward neofunctionalization. Quite a few stress/hormone-related responsive elements were found in promoter regions indicating potential response to various external factors. Transcriptome data revealed some NAC TFs were involved in pneumatophore and leaf salt gland development and response to salt, flooding and Cd stresses. Gene co-expression analysis found a few NAC TFs participates in the special biological processes concerned with adaptation to intertidal environment. In summary, this study provides detailed functional and evolutionary information about NAC gene family in mangrove plant A. marina and new perspective for adaptation to intertidal habitats.


Subject(s)
Avicennia , Avicennia/chemistry , Avicennia/genetics , Avicennia/metabolism , Phylogeny , Transcription Factors/metabolism , Genes, Plant , Ecosystem
18.
Opt Express ; 31(1): 774-775, 2023 Jan 02.
Article in English | MEDLINE | ID: mdl-36607010

ABSTRACT

Erratum to "Creating perfect composite vortex beams with a single all-dielectric geometric metasurface." [Opt. Express30, 40231 (2022)10.1364/OE.475158]. Here are some mistakes in the paper, which needs to be revised.

19.
Plant Dis ; 107(8): 2500-2505, 2023 Aug.
Article in English | MEDLINE | ID: mdl-36691281

ABSTRACT

A Pantoea ananatis strain, named LCFJ-001 (GDMCC: 1.6101), was isolated for the first time from bacterial wilt-diseased roots of mulberry (Morus atropurpurea) in the western part of the Guangxi Zhuang Autonomous Region, China. Moreover, through Koch's postulates, it was proven that LCFJ-001 can cause mulberry wilt, which is one of the pathogens of mulberry bacterial wilt. Here, we report a complete, annotated genome sequence of P. ananatis LCFJ-001. The entire genome sequence of P. ananatis strain LCFJ-001 was a 4,499,350 bp circular chromosome with 53.50% GC content. In total, 3,521 genes were annotated, of which 3,418 were assigned protein-coding genes. In addition, 22 ribosomal RNAs and 81 transfer RNAs were identified. The presented resource will help explore the pathogenetic mechanisms of mulberry wilt disease caused by the genus Pantoea.


Subject(s)
Morus , Pantoea , Genome, Bacterial , Pantoea/genetics , Morus/microbiology , China
20.
Plant Cell Environ ; 46(5): 1521-1539, 2023 05.
Article in English | MEDLINE | ID: mdl-36658747

ABSTRACT

Hydrogen sulfide (H2 S) is considered to mediate plant growth and development. However, whether H2 S regulates the adaptation of mangrove plant to intertidal flooding habitats is not well understood. In this study, sodium hydrosulfide (NaHS) was used as an H2 S donor to investigate the effect of H2 S on the responses of mangrove plant Avicennia marina to waterlogging. The results showed that 24-h waterlogging increased reactive oxygen species (ROS) and cell death in roots. Excessive mitochondrial ROS accumulation is highly oxidative and leads to mitochondrial structural and functional damage. However, the application of NaHS counteracted the oxidative damage caused by waterlogging. The mitochondrial ROS production was reduced by H2 S through increasing the expressions of the alternative oxidase genes and increasing the proportion of alternative respiratory pathway in the total mitochondrial respiration. Secondly, H2 S enhanced the capacity of the antioxidant system. Meanwhile, H2 S induced Ca2+ influx and activated the expression of intracellular Ca2+ -sensing-related genes. In addition, the alleviating effect of H2 S on waterlogging can be reversed by Ca2+ chelator and Ca2+ channel blockers. In conclusion, this study provides the first evidence to explain the role of H2 S in waterlogging adaptation in mangrove plants from the mitochondrial aspect.


Subject(s)
Avicennia , Hydrogen Sulfide , Hydrogen Sulfide/pharmacology , Hydrogen Sulfide/metabolism , Calcium/metabolism , Avicennia/metabolism , Reactive Oxygen Species/metabolism , Oxidative Stress
SELECTION OF CITATIONS
SEARCH DETAIL
...